Molecular Dynamics Simulation of the Inhibition of HIV-1 Protease by RNA Aptamer: Effect of Mutation

سال انتشار: 1397
نوع سند: مقاله کنفرانسی
زبان: انگلیسی
مشاهده: 484

نسخه کامل این مقاله ارائه نشده است و در دسترس نمی باشد

این مقاله در بخشهای موضوعی زیر دسته بندی شده است:

استخراج به نرم افزارهای پژوهشی:

لینک ثابت به این مقاله:

شناسه ملی سند علمی:

ISPTC21_262

تاریخ نمایه سازی: 30 دی 1397

چکیده مقاله:

The human immunodeficiency virus tpe-1 (HIV-1), a member of retrovirus family, has been acausative organism in an acquired immunodeficiency syndrome (AIDS). One of the important enzymesnecessary for the replication of this virus is HIV-1 protease (HIV-1 PR). Thus, searching for HIV-1 PRinhibitors from natural sources has become a promising approach [1]. HIV-1 aspartyl protease (PR) plays akey role in virion morphogenesis, underscoring the effectiveness of protease inhibitors (PI) [2]. In thepresent study, we studied two aptamers with nucleotid sequencing ofCCGGGTCGTCCCCTACGGGGACCTAAAGACTGTGTCCAACCGCCCTCGCCT named as AP1 andAP2 with nucleotid sequencing ofCTTCATTGTAACTTCTCATAATTTCCCGAGGCTTTTACTTTCGGGGTCCT and a mutant structureof it named as AP3. In the mutated aptamer C, T, A, C and C nucleotids of AP2 were substituted with A,G, G, A and T to yield AP3. The considered aptamers have been studied experimentaly by Duclair et al [2]from the stability and HIV-1 protease binding ability aspects. Structures of HIV-1 protease enzyme wastaken from Protein Data Bank (http://www.pdb.org/pdb/). Classical molecular dynamics simulations wereperformed using NAMD package [3], and visual molecular dynamics (VMD) [4] was used for visualizationand analysis of the trajectories. The results of the simulation including structural results like RMSD,hydrogen bonds and radial distribution functions as well as energetics of the complex like interactionenergy and the contribution of van der Waals and electrostatic interactions in it have been extracted anddiscussed. The structural results show that the aptamers bind to the active site of considered enzyme andthe energetic results show that the aptamers have relatively high affinity to their targets. A further studyreveals that there is a direct correlation between the length of RNA aptamer and the strength of aptamerbinding to the target. In addition to the above results, we have also described the nature of interaction andbinding characterization by the using of the variations in the secondary structures and the distribution ofinteraction energies. Although the AP1 aptamer was the best inhibitor it was not the species with thehighest affnity for HIV-1 PR. The mutant aptamers also exhibited enhanced effcacy in inhibiting theactivity of PR compared to the parental sequences. Finally, with due attention to the high effectivenessand the proprietary function of aptamers, we can conclude that these compounds may be considered aseffective HIV-1 antiprotease drugs.

نویسندگان

Marzieh Ajamgard

Molecular Simulation laboratory (MSL), Azarbaijan Shahid Madani University, Tabriz, Iran

Jaber Jahanbin Sardroodi

Molecular Simulation laboratory (MSL), Azarbaijan Shahid Madani University, Tabriz, Iran

Alireza Rastkar Ebrahimzadeh

Molecular Simulation laboratory (MSL), Azarbaijan Shahid Madani University, Tabriz, Iran