RT-PCR detection and identification of Fig Mosaic Virus (FMV)– Arak isolates

سال انتشار: 1397
نوع سند: مقاله کنفرانسی
زبان: انگلیسی
مشاهده: 545

نسخه کامل این مقاله ارائه نشده است و در دسترس نمی باشد

استخراج به نرم افزارهای پژوهشی:

لینک ثابت به این مقاله:

شناسه ملی سند علمی:

CIGS15_171

تاریخ نمایه سازی: 13 بهمن 1398

چکیده مقاله:

Common fig (Ficus carica L.) is a deciduous shrub with smooth white bark. Its leaves are deeply lobed with three or five lobes in the mulberry family. Figs can be eaten fresh or dried, and used in jam-making. It contain diverse phytochemicals, including polyphenols such as gallic acid, chlorogenic acid and syringic acid. Fig mosaic disease is recognized as economically important due to its worldwide occurrence and to premature fruit drop. Several viruses and viroids have been identified with this disease. Fig mosaic virus (FMV) is the type species of the genus Emaravirus in the family Bunyaviridae and is transmitted mainly by the eriophyid mite Aceria ficus. During autumn of 2016, a total number of 46 Common fig leaves with symptoms including mosaic and yellowing were collected from Arak. Total RNA was extracted using with Column RNA isolation kit (Denazist Asia, Iran) and were used in reverse transcription polymerase chain reaction (RT-PCR) using specific primer pair to amplify a partial sequence of glycoprotein (GP). Synthesis of cDNA was performed using FMV-GP-R (TATTACCTGGATCAACGCAG). cDNA product was subjected to PCR using 0.4 pmol of FMV-GP-R and FMV-GP-F (ACTTGCAAAGGCAGATGATA). A fragment with 700bp in length, in 12 samples was amplified. The amplified fragments were investigated in 1% agarose gel and were sequenced by Macrogene company. Nucleotide sequences of amplicons were compared with previously reported FMV from other countries using Blastn software available at GenBank, revealed the highest identity as 89-99% at nucleotide level and 85-92% at amino acid level.

کلیدواژه ها:

نویسندگان

Faezehossadat Abtahi

Department of Medinal Plants, Faculty of Agriculture and Natural Resourses, Arak University, Arak ۳۸۱۵۶-۸-۸۳۴۹, Iran.

Mehrnaz Hatami

Department of Medinal Plants, Faculty of Agriculture and Natural Resourses, Arak University, Arak ۳۸۱۵۶-۸-۸۳۴۹, Iran.