Isolation and characterization of promoter sequence of ZNF703 gene and related transcription factors via genomeinformatics analysis

  • سال انتشار: 1394
  • محل انتشار: یازدهمین کنگره بین المللی سرطان پستان
  • کد COI اختصاصی: ICBCMED11_075
  • زبان مقاله: انگلیسی
  • تعداد مشاهده: 447
دانلود فایل این مقاله

نویسندگان

Somaye Ghanaat doust

Department of biotechnology…، Urmia Branch، Islamic Azad University، Urmia،Iran

چکیده

Somaye.Ghanaat doust: Department of biotechnology…، Urmia Branch، Islamic Azad University، Urmia،Iran Introduction: Znf703 gene is the producer of zinc finger protein and located on human chromosome 8. ZNF703 gene s role in breast cancer progression and metastasis in a mouse cancer cell line has been identified. In these cellshigh expression of ZNF703 suppress the expression of E-Cadherin.due the proliferation and invasion of breast cancer cells will be increase. Method: Download the complete sequence of znf703 gene from ncbi database then selected 751 nocleotide from upstream of the gene as a potential area.the selected area was under scrutiny with consite and Promoter Prediction by Neural Network data bases. regulatory elements were identified Results was approved by easynn-plus application based on artificial intelligence. Results: Based on the Promoter Prediction by Neural Network database resulte sequences 37695578 to 37695628 were detected as promoter Start End Score Promoter Sequence 578 628 0.86 CGGGAGCGGCCGAGACCGAGGCAGCGGCGGCGCGCGGCGCGGCCCCTTTA Some transcription factors identified in the consite database is as the below: NF-Y,Myf,CFI-USP,Bsap,CREB,TBP,SRF,AGL3,E74A,NF-KappaB,P50,COUPTF, C-REL,Dorsal2,AML-1,Thing1-E47,SOX17,Bzip410,HFH- 3,USF,ARNT,SPZ1,RREB-1,chop-Cebp,BSap,FREAC-4,n-Myc,Snail Discussion and conclusion Given that no such study has been done about the identification of znf703 geneʼs promoter. for the first time, This study has been able to effectively identify the area. It can be said with certainty that the desired area is containing the gene znf703 promoter.

کلیدواژه ها

breast cancer ,znf703 gene,prompter

مقالات مرتبط جدید

اطلاعات بیشتر در مورد COI

COI مخفف عبارت CIVILICA Object Identifier به معنی شناسه سیویلیکا برای اسناد است. COI کدی است که مطابق محل انتشار، به مقالات کنفرانسها و ژورنالهای داخل کشور به هنگام نمایه سازی بر روی پایگاه استنادی سیویلیکا اختصاص می یابد.

کد COI به مفهوم کد ملی اسناد نمایه شده در سیویلیکا است و کدی یکتا و ثابت است و به همین دلیل همواره قابلیت استناد و پیگیری دارد.