In silico Design of a Multi-Epitope mRNA Vaccine Against Newcastle Disease Virus

سال انتشار: 1405
نوع سند: مقاله کنفرانسی
زبان: انگلیسی
مشاهده: 63

متن کامل این مقاله منتشر نشده است و فقط به صورت چکیده یا چکیده مبسوط در پایگاه موجود می باشد.
توضیح: معمولا کلیه مقالاتی که کمتر از ۵ صفحه باشند در پایگاه سیویلیکا اصل مقاله (فول تکست) محسوب نمی شوند و فقط کاربران عضو بدون کسر اعتبار می توانند فایل آنها را دریافت نمایند.

استخراج به نرم افزارهای پژوهشی:

لینک ثابت به این مقاله:

شناسه ملی سند علمی:

AGRIHAMAYESH10_116

تاریخ نمایه سازی: 14 شهریور 1405

چکیده مقاله:

Newcastle disease (ND) is one of the most devastating viral diseases in the poultry industry, caused by Newcastle disease virus (NDV). Despite their widespread use, traditional vaccines face limitations such as inadequate mucosal immunity, interference with maternal antibodies, and the need for cold chain maintenance. mRNA vaccine technology, with its rapid design capability and simultaneous induction of humoral and cellular immunity, has opened new perspectives for controlling this disease. This study aimed to design a bioinformatics-based multi-epitope mRNA vaccine targeting the F protein of Newcastle disease virus and evaluate its structural stability. The F protein sequence (Q۵XQ۲۹) was retrieved from the UniProt database. MHC class I and II binding epitopes were predicted using IEDB tools. Immunogenicity was assessed with VaxiJen, toxicity with ToxinPred, and allergenicity with Aller CatPro. Final epitopes were selected based on weighted criteria (MHC binding: ۴۰%, immunogenicity: ۲۵%, non-toxicity: ۲۰%, non-allergenicity: ۱۵%), and codon optimization was performed according to chicken codon usage. The vaccine construct was designed using SnapGene, and its stability was evaluated with RNAfold. From the F protein, the epitopes MRATYLETL (MHC I), YTSSQTGSI (MHC I), and ATYQKNISILD (MHC II) were selected. These epitopes were incorporated into the final construct with the optimized nucleotide sequences ATGCGGGCCACCTACCTGGAGACCCTG, TACACCAGCAGCCAGACCGGCAGCATC, and GCCACCTACCAGAAGAACATCAGCATCCTGGAC. The construct was designed with a Moderna cap, ۵' UTR leader, epitopes linked by GGGS linkers, ۳' UTR, and a poly-A tail (۱۲۰ nucleotides). The minimum free energy (MFE) was -۲۹.۶۰ kcal/mol, with an ensemble diversity of ۶۲.۱۹%, indicating favorable thermodynamic stability. The overall construct score was ۷۰% (stability: ۸/۱۰, antigenic diversity: ۶/۱۰). The designed multi-epitope mRNA vaccine based on the NDV F protein exhibits favorable structural stability and can serve as a suitable candidate for in vitro studies and evaluation of synergistic effects with probiotics in controlling Newcastle disease.