A Novel Nucleolin Targeted Biosensor forSimple and Sensitive Cancer Detection

Introduction: Nucleolin is a multifunctional protein involvedin various cellular processes including transcription, RNA processing,ribosome biogenesis, and DNA repair. Overexpression of nucleolin is associated with several types of cancer, makingit an attractive target for cancer detection and treatment.Several methods have been reported for cancer detection, includingimaging techniques, tumor biomarkers, and biopsies.However, these methods have limitations including high cost,invasiveness, and low sensitivity and specificity. Therefore, thedevelopment of alternative diagnostic methods such as biosensorsis of great interest. Nucleolin-based biosensors are promisingfor addressing the growing need for reliable and sensitivecancer detection methods. In this study, we introduced anucleolin-based biosensor that provides a promising solutionto this problem.Materials and Methods: To produce a specific biosensor, weinvestigated several parameters, including the sequence of theG-quadruplex and aptamer, ion concentration, Tm, secondarystructure, and intramolecular interaction between the G-quadruplexand aptamer. The G-quadruplex sequence (۵′-ACAGGGTTTGGGTTTGGGTTTGGGACA-۳′) and aptamer sequence(۵′- GGTGGTGGTGGTTGTGGTGGTGGTGG-۳′)were selected based on bioinformatics analysis. We then designeda random hexamer (TAATAA) between the G-quadruplexand the aptamer to obtain a biosensor for nucleolin detection.Results: Our results indicated that there was no interference betweenthe G-quadruplex and the related aptamer. Moreover, theG-quadruplex region with a high G-score (۴۲) can form a stableartificial enzyme. Therefore, the designed nucleolin-basedbiosensor (۵′- ACAGGGTTTGGGTTTGGGTTTGGGACATAATAAGGTGGTGGTGGTTGTGGTGGTGGTGG-۳′) couldspecifically bind to nucleolin and generate a colorimetric andmeasurable signal using peroxidase-like activity.Conclusion: Our study has led to the design of a new nucleolinbasedbiosensor with high specificity and sensitivity for cancerdetection. This biosensor provides a simple, sensitive, cheap,and available method for detecting different types of cancerwith high specificity towards nucleolin, offering advantagesover other diagnostic methods that may suffer from human errorsand produce false-positive and false-negative Results: Withthe potential to revolutionize cancer detection and treatment,this new biosensor provides a promising alternative to traditionaldiagnostic methods, and has the potential to significantlyimpact the field of cancer diagnosis and treatment

کلیدواژه ها:

Nucleolin ، Aptamer ، G-quadruplex ، Cancer ، Biosensor