Determining suitable primers for use in DNA barcoding protocol to detect canned tuna fishes

سال انتشار: 1401
نوع سند: مقاله کنفرانسی
زبان: انگلیسی
مشاهده: 163

نسخه کامل این مقاله ارائه نشده است و در دسترس نمی باشد

استخراج به نرم افزارهای پژوهشی:

لینک ثابت به این مقاله:

شناسه ملی سند علمی:

ICFAR06_112

تاریخ نمایه سازی: 12 مهر 1402

چکیده مقاله:

One of the important objects in monitoring the production of marine products is to ensure the accuracy of the product label. The non-compliance of the fish species used in canned fish with what is mentioned in the product label has been reported in numerous reports in the various countries. Due to the change in shape and initial texture of the product, it is very difficult to identify the fish used in canned food in some cases. In recent years, with the use of new biotechnological methods, it has been possible to control health and prevent food adulteration. Among the new methods of preventing fraud, genetic methods such as DNA barcoding have high accuracy and precision. It may be said that one of the most important steps of using this method is choosing suitable primers for the replication of a universal fragment from a certain part of DNA.Due to the conditions created during canning, especially the use of heat and high pressure, parts of DNA are destroyed. This problem reduces the performance of the PCR process due to the reduction of the efficiency of the primer used. For this purpose, in the present study, different primers were investigated for the amplification of the appropriate fragment of the cytochrome oxidase ۱ gene for canned tuna meat.In this process, after extracting DNA from the meat of ۴ types of canned tuna (gaider, havoor, havoor masqaty, zardeh) and determining the necessary quality using electrophoresis and spectrophotometry, ۷ primers are used to amplify the desired fragments of the cytochrome oxidase ۱ gene. Then, the amplified fragments were evaluated for quality and the PCR product with the most appropriate quality in terms of the absence of amplification of additional fragments was purified from gel electrophoresis and sequenced. The results obtained from checking the quality of the PCR product and sequencing the obtained fragments showed that among the primers used, the Minibarcoding primer (F: ATCACAAAGACATTGGCACCCT, R: AATGAAGGGGGGAGGAGTCAGAA) has the most appropriate quality and performance and is recommended for use in the DNA barcoding method for canned tuna.

نویسندگان

M Aivaz

Food Sciences and Technology Dept. Najafabad Azad Islamic University Unit, Najafabad, Iran

M Zolfaghari

Seafood Sciences and Technology Dept. Gorgan University of Agricultural Sciences and Natural Resources, Gorgan, Iran

M Nasr Esfahani

Chemistry Dept. Najafabad Azad Islamic University Unit, Najafabad, Iran

H Paknejad

Aquatics Reproduction and culture Dept. Gorgan University of Agricultural Sciences and Natural Resources, Gorgan, Iran