Design of shRNAs against Yaba monkey tumor virus byinsulin metalloprotease-like protein gene

سال انتشار: 1401
نوع سند: مقاله کنفرانسی
زبان: انگلیسی
مشاهده: 307

نسخه کامل این مقاله ارائه نشده است و در دسترس نمی باشد

این مقاله در بخشهای موضوعی زیر دسته بندی شده است:

استخراج به نرم افزارهای پژوهشی:

لینک ثابت به این مقاله:

شناسه ملی سند علمی:

MEDISM23_555

تاریخ نمایه سازی: 16 مهر 1401

چکیده مقاله:

Background and Aim : Yaba monkey tumor virus (YMTV) is a member of the Yata pox virusfamily. This virus is one of the few smallpox viruses that cause tumors during infection. The virusgets its name from the suburb of Yaba, Lagos because the first case of the virus was obtained fromthere. In YMTV-infected rhesus monkeys, tumors are thought to derive from histiocytes that havemigrated to the site of infection. When the histiocytes are infected, they start multiplying rapidlyand become multinucleated and eventually form a polyclonal tumor. Although, the host reservoirof YMTV has not been precisely defined, All pox virus infections have a zoonotic potential. it isassumed that the virus can at least partially cope the mammalian/human immune system byexpressing immunomodulatory proteins.Methods : ShRNA sequences were designed against insulin metalloprotease-like protein gene ofYaba monkey tumor virus using the www.invivogen.com/sirna-wizard website and the mosteffective molecules were selected using background information. For this purpose, standard searchmethod selected and siRNA motifs with the desired size and thermodynamic properties weredesigned. Then, in order to design hairpin, the proposed vector and loop sequences (TCAAGAG)submitted, so the most effective shRNAs with desired restriction enzyme sites were designedResults : One potentially effective shRNA molecule was designed. Its sequence and start targetposition included YabaV shRNA۱: CTCATATAACTTCTAGCCGTTGATTCAAGAGATCAACGGCTAGAAGTTATATGAG with start position of ۱۸ of Yaba monkeytumor virus insulin metalloprotease-like protein gene gene.Conclusion : The results showed that there are potentially effective shRNA molecules againstYaba monkey tumor virus insulin metalloprotease-like protein gene that can suppress itstranslation and can be considered as an antiviral approach based on RNA۱

کلیدواژه ها:

نویسندگان

Soren Nooraei

D.V.M Student, Department of Pathobiology , Faculty of Veterinary Medicine, Shahrekord University , Sharekord , Iran

Azam Mokhtari

Associate Professor, Department of Pathobiology , Faculty of Veterinary Medicine, Shahrekord University , Sharekord , Iran