Detection of Panton-valentine Leukocidin (PVL) GeneIsoforms of Staphylococcus aureus Isolates from different hospitals inTehran, Iran
محل انتشار: بیست و سومین کنگره بین المللی میکروب شناسی ایران
سال انتشار: 1401
نوع سند: مقاله کنفرانسی
زبان: انگلیسی
مشاهده: 97
نسخه کامل این مقاله ارائه نشده است و در دسترس نمی باشد
- صدور گواهی نمایه سازی
- من نویسنده این مقاله هستم
استخراج به نرم افزارهای پژوهشی:
شناسه ملی سند علمی:
MEDISM23_086
تاریخ نمایه سازی: 16 مهر 1401
چکیده مقاله:
Background and Aim : PVL is a two-component toxin produced by some S. aureus strains invarying amounts. To date, at least ۲۲ single-nucleotide polymorphisms (SNPs) have beenidentified in the lukSF-PV genes based on phylogenetic analysis. PVL-positive S. aureus strainscould be classified into four major haplotype groups (R, H۱, H۲, H۳) based on non-synonymousvariations in the PVL sequence at nucleotide positions ۵۲۷,۶۶۳, and ۱۳۹۶. This study attempts todetermine isoforms PVL-positive isolates in clinical samples and the molecular characterizationof PVL-positive isolates.Methods : In this study, ۶۰۰ isolates of S. aureus were collected between February ۲۰۱۶and March۲۰۱۹ from different hospitals in Tehran, Iran.A total of ۲۸ PVL-positive S. aureus strains weredetected. A PCR-based sequencing method was applied to determine SNPs in the lukSF-PV genesof all S. aureus strains. PCR amplifications were performed using a primer pair (lukS-FGTGGTCCATCAACAGGAGGT and lukF-R TGGTCCCCAACCATTATTCA) specificallydesigned to generate a ۱۱۰۷ bp fragment (nucleotides ۴۴۰ to ۱۵۴۶) of the lukSF-PV genes.Results : As expected, the sequences were highly conserved, but nucleotide variations wereobserved at seven sites (positions ۴۷۰, ۵۲۷, and ۶۶۳ located in the lukS locus and positions ۱۳۰۴,۱۳۱۸, ۱۳۹۳, and ۱۳۹۶ located in the lukF locus) using the lukSF-PV genes of MRSA strainUSA۳۰۰ as a reference. Among the isolates, ۱۹ (۶۷.۹%) isolates were of H variant and theremaining nine (۳۲.۱%) isolates were identified as R variant, Also, H variants were furtherclassified into H۱ (۴/۲۸, ۱۴.۳%) and H۲ (۱۵/۲۸, ۵۳.۶%) groups. Furthermore, H۱ variants werefurther divided into H۱a (n = ۳) and H۱b (n = ۱) groups. Additionally, H۲ variants were groupedinto H۲a (n = ۱۴) and H۲b (n = ۱) groups.Conclusion : Since the infections caused by PVL-positive S. aureus strains have high virulenceand regional differences in the prevalence of PVL gene and its isoforms may affect the clinicalspectrum of staphylococcal infections, so knowledge about the prevalence of strains containingPVL gene and isoform distribution can be helpful in estimating their pathogenicity andimplementing better treatment policies. Both R and H variants were detected among S. aureusstrains in Iran
کلیدواژه ها:
نویسندگان
Zahra Najafi olya
Hepatitis Research Center, School of medicine, Lorestan university of Medical Sciences, Khorramabad, Iran
Abbas Yadegar
Foodborne and Waterborne Diseases Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran
Bita Bakhshi
Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University,, Tehran, Iran