Isolation and characterization of promoter sequence of ZNF703 gene and related transcription factors via genomeinformatics analysis

سال انتشار: 1394
نوع سند: مقاله کنفرانسی
زبان: انگلیسی
مشاهده: 476

نسخه کامل این مقاله ارائه نشده است و در دسترس نمی باشد

این مقاله در بخشهای موضوعی زیر دسته بندی شده است:

استخراج به نرم افزارهای پژوهشی:

لینک ثابت به این مقاله:

شناسه ملی سند علمی:

ICBCMED11_075

تاریخ نمایه سازی: 21 اردیبهشت 1397

چکیده مقاله:

Somaye.Ghanaat doust: Department of biotechnology…، Urmia Branch، Islamic Azad University، Urmia،Iran Introduction: Znf703 gene is the producer of zinc finger protein and located on human chromosome 8. ZNF703 gene s role in breast cancer progression and metastasis in a mouse cancer cell line has been identified. In these cellshigh expression of ZNF703 suppress the expression of E-Cadherin.due the proliferation and invasion of breast cancer cells will be increase. Method: Download the complete sequence of znf703 gene from ncbi database then selected 751 nocleotide from upstream of the gene as a potential area.the selected area was under scrutiny with consite and Promoter Prediction by Neural Network data bases. regulatory elements were identified Results was approved by easynn-plus application based on artificial intelligence. Results: Based on the Promoter Prediction by Neural Network database resulte sequences 37695578 to 37695628 were detected as promoter Start End Score Promoter Sequence 578 628 0.86 CGGGAGCGGCCGAGACCGAGGCAGCGGCGGCGCGCGGCGCGGCCCCTTTA Some transcription factors identified in the consite database is as the below: NF-Y,Myf,CFI-USP,Bsap,CREB,TBP,SRF,AGL3,E74A,NF-KappaB,P50,COUPTF, C-REL,Dorsal2,AML-1,Thing1-E47,SOX17,Bzip410,HFH- 3,USF,ARNT,SPZ1,RREB-1,chop-Cebp,BSap,FREAC-4,n-Myc,Snail Discussion and conclusion Given that no such study has been done about the identification of znf703 geneʼs promoter. for the first time, This study has been able to effectively identify the area. It can be said with certainty that the desired area is containing the gene znf703 promoter.

کلیدواژه ها:

نویسندگان

Somaye Ghanaat doust

Department of biotechnology…، Urmia Branch، Islamic Azad University، Urmia،Iran