Molecular Detection of Freemartinism in Female Calves Using Amelogenin Gene Polymorphisms

سال انتشار: 1404
نوع سند: مقاله کنفرانسی
زبان: انگلیسی
مشاهده: 1

متن کامل این مقاله منتشر نشده است و فقط به صورت چکیده یا چکیده مبسوط در پایگاه موجود می باشد.
توضیح: معمولا کلیه مقالاتی که کمتر از ۵ صفحه باشند در پایگاه سیویلیکا اصل مقاله (فول تکست) محسوب نمی شوند و فقط کاربران عضو بدون کسر اعتبار می توانند فایل آنها را دریافت نمایند.

استخراج به نرم افزارهای پژوهشی:

لینک ثابت به این مقاله:

شناسه ملی سند علمی:

IVSC13_0294

تاریخ نمایه سازی: 3 اسفند 1404

چکیده مقاله:

Background: Freemartinism represents the most prevalent disorder of sexual development, leading to infertility in heifers born from different-sex twin pregnancies. The early fusion of placental blood vessels between the male and female embryos results in hematologic chimerism (۶۰, XX/XY). The transmission of masculinizing substances—including anti-Müllerian hormone and androgens—disrupts the proper development of the ovaries and reproductive ducts in the female. The aim of this study was to evaluate a simple multiplex PCR as a sensitive and reliable method for the diagnosis of freemartinism in female calves with no available birth history and without the possibility of clinical or rectal examination. Methods: In this study, molecular sex determination was conducted on a freemartin case as well as on normal male and female calves that served as controls. Whole blood samples were collected in EDTA tubes, and genomic DNA was extracted using the DNeasy Blood & Tissue Kit (Parstus, Iran) according to the manufacturer’s instructions. Sex identification was based on detection of Y chromosome sequences through insertion/deletion (InDel) polymorphisms in the amelogenin X and Y genes (AMLX/Y), using the following primers: forward ۵′ CAGCCAAACCTCCCTCTGC ۳′ and reverse ۵′ CCCGCTTGGTCTTGTCTGTTGC ۳′, following previously described protocols. A simple multiplex PCR was performed under standard cycling conditions: initial denaturation at ۹۴ °C for ۵ min; ۳۷ cycles of ۹۴ °C for ۴۵ s, ۶۴.۷ °C for ۴۵ s, and ۷۲ °C for ۳۰ s; followed by a final extension at ۷۲ °C for ۵ min. Amplified products were resolved on ۱.۵% agarose gel and visualized under UV illumination after ethidium bromide staining. Results: Normal female calves yielded a single ۲۸۰ bp band corresponding to the X chromosome, whereas male calves displayed two bands at ۲۸۰ bp (X) and ۲۱۷ bp (Y). All assays were performed in duplicate. In the freemartin case, the ۲۱۷ bp band appeared markedly weaker than the ۲۸۰ bp band, indicating the presence of a chimeric XX/XY chromosomal pattern. Conclusion: PCR detection of amelogenin X and Y gene polymorphisms provides a rapid and reliable method not only for distinguishing male and female calves, but also for identifying freemartinism in females, thereby improving herd management by preventing the rearing of infertile animals.

نویسندگان

Tina Yaghoobpour

Department of Clinical Sciences, Faculty of Veterinary Medicine, Shiraz University, Shiraz, Iran

Hassan Sharifiyazdi

Department of Clinical Sciences, Faculty of Veterinary Medicine, Shiraz University, Shiraz, Iran

Peyman Zamani

Department of Clinical Sciences, Faculty of Veterinary Medicine, Shiraz University, Shiraz, Iran

Sahar Hosseini

Department of Clinical Sciences, Faculty of Veterinary Medicine, Shiraz University, Shiraz, Iran