Background: Freemartinism represents the most prevalent disorder of sexual development, leading to infertility in heifers born from different-sex twin pregnancies. The early fusion of placental blood vessels between the male and female embryos results in hematologic chimerism (۶۰, XX/XY). The transmission of masculinizing substances—including anti-Müllerian hormone and androgens—disrupts the proper development of the ovaries and reproductive ducts in the female. The aim of this study was to evaluate a simple multiplex
PCR as a sensitive and reliable method for the diagnosis of freemartinism in female calves with no available birth history and without the possibility of clinical or rectal examination. Methods: In this study, molecular sex determination was conducted on a freemartin case as well as on normal male and female calves that served as controls. Whole blood samples were collected in EDTA tubes, and genomic DNA was extracted using the DNeasy Blood & Tissue Kit (Parstus, Iran) according to the manufacturer’s instructions. Sex identification was based on detection of Y chromosome sequences through insertion/deletion (InDel) polymorphisms in the amelogenin X and Y genes (AMLX/Y), using the following primers: forward ۵′ CAGCCAAACCTCCCTCTGC ۳′ and reverse ۵′ CCCGCTTGGTCTTGTCTGTTGC ۳′, following previously described protocols. A simple multiplex
PCR was performed under standard cycling conditions: initial denaturation at ۹۴ °C for ۵ min; ۳۷ cycles of ۹۴ °C for ۴۵ s, ۶۴.۷ °C for ۴۵ s, and ۷۲ °C for ۳۰ s; followed by a final extension at ۷۲ °C for ۵ min. Amplified products were resolved on ۱.۵% agarose gel and visualized under UV illumination after ethidium bromide staining. Results: Normal female calves yielded a single ۲۸۰ bp band corresponding to the X chromosome, whereas male calves displayed two bands at ۲۸۰ bp (X) and ۲۱۷ bp (Y). All assays were performed in duplicate. In the freemartin case, the ۲۱۷ bp band appeared markedly weaker than the ۲۸۰ bp band, indicating the presence of a chimeric XX/XY chromosomal pattern. Conclusion:
PCR detection of amelogenin X and Y gene polymorphisms provides a rapid and reliable method not only for distinguishing male and female calves, but also for identifying freemartinism in females, thereby improving herd management by preventing the rearing of infertile animals.