Investigating the relationship between the expression of DDX۲۱ and mir۲۰۰a genes with the prognosis of colorectal cancer patients

سال انتشار: 1403
نوع سند: مقاله کنفرانسی
زبان: انگلیسی
مشاهده: 125

نسخه کامل این مقاله ارائه نشده است و در دسترس نمی باشد

استخراج به نرم افزارهای پژوهشی:

لینک ثابت به این مقاله:

شناسه ملی سند علمی:

ICGCS02_199

تاریخ نمایه سازی: 17 دی 1403

چکیده مقاله:

Abstract Colorectal cancer (CRC) is a significant health problem as the third most common cancer in the world and the second deadliest cancer in the world. The aim of the present study was to evaluate expression of two genes (DDX۲۱ and mir۲۰۰a) in Iranian CRC patients tissue samples. In this study, ۶۰ patients with colorectal cancer and ۶۰ patients with no evidence of CRC were enrolled. RNA extraction from The paraffin blocks of colorectal tissue samples and polyps was performed and expression level of DDX۲۱ and mir۲۰۰a genes was assessed using qPCR method. The results showed that mean age of patients was ۵۸.۳ ± ۹.۸۲ years and ۵۳.۷ ± ۸.۶۵ years in the case and control groups respectively. The expression of DDX۲۱ was significantly increased in CRC patients (with a mean fold-change of ۱.۸, P<۰.۰۰۱). Additionally, the expression of miR-۲۰۰a was significantly increased in CRC patients (with a mean fold-change of ۲.۵, P<۰.۰۰۱). In conclusion, DDX۲۱ and mir۲۰۰a seem to be valuable markers in prognosis of CRC..... Methods Study Design and Patients In this study, ۶۰ patients with colorectal cancer and ۶۰ controls (with no evidence of CRC) were enrolled. The paraffin blocks of colon and rectum tissue samples in the case group and polyps in the control group, were prepared by the Pathology Department of Imam Hossein hospital (Tehran, Iran). The results of histopathological studies confirmed CRC diagnosis in the case group patients. RNA isolation and qPCR Isolation of RNA performed in using the MiRJia Kit (Rojeh Technology, Iran) and were used for cDNA synthesis with random hexamers and Superscript III Reverse Transcriptase according to manufacturer’s instructions (ThermoFischer). cDNA was used for quantitative PCR analysis in a Step one real-time PCR cycler (Applied Biosystem), using SYBR Green Master Mix and gene-specific primers. The DDX۲۱ gene primer sequences were (Forward): CGGAGGACGGGGTGAAGAT and (Reverse): AAGAAGGTTCTGAACAGCTGGTTAG. Primer sequences of miR-۲۰۰a were (Forward): UAACACUGUCUGGUAACGAUGU and (Reverse): UAACACUGUCUGGUAACGAUGU.

کلیدواژه ها:

نویسندگان

Fahimeh Zanganeh

Department of Microbiology, Qom Branch, Islamic Azad University, Qom, Iran

Niloufar Sadat Kalaki

Department of Cell & Molecular Biology, Faculty of Biological Sciences, Kharazmi University, Tehran, Iran

Abdolreza Soraghi

Department of Genetics, Faculty of Advanced Science and Technology, Tehran Medical Sciences, Islamic Azad University, Tehran, Iran

Amin Pourzarin

Department of Biology, Science and Research Branch, Islamic Azad University, Tehran, Iran

Farnaz Vahidian

Human Genetics Research Center, Baqiyatallah University of Medical Sciences, Tehran, Iran

Hasan Ashoori

Baqiyatallah Research Center of Gastroenterology and Liver Disease, Baqiyatallah University of Medical Sciences, Tehran, Iran