An Investigation of Promoter-Targeted Small Activating RNAs on BMP۲ Up-Regulation
محل انتشار: چهاردهمین کنگره بین المللی سلول های بنیادی رویان
سال انتشار: 1397
نوع سند: مقاله کنفرانسی
زبان: انگلیسی
مشاهده: 106
نسخه کامل این مقاله ارائه نشده است و در دسترس نمی باشد
- صدور گواهی نمایه سازی
- من نویسنده این مقاله هستم
استخراج به نرم افزارهای پژوهشی:
شناسه ملی سند علمی:
SCROYAN14_107
تاریخ نمایه سازی: 14 آبان 1403
چکیده مقاله:
Background: saRNAs (Small activating RNAs) are smalldouble-stranded RNAs (dsRNAs )that target gene promoters toinduce transcriptional gene activation in a process known asRNA activation ( RNAa) .In this study we are going to investigatethe likelihood to enhance the BMP۲ expression in humanMesenchymal Stem Cells (hMSCs) using specifically designedsaRNAs. If so, we can use the designed saRNAs as affordablesmall osteogenic factors in synthetic bone grafts and substitutematerials instead of expensive BMP۲ proteins with side effects.Materials and Methods: First, Two different dsRNAs targetingBMP۲ promoter are designed using short hairpin RNAtarget design tools including DSIR and Dharmacon. Secondly,the dsRNA inserts are separately ligated into pCDH vector,and then transformed using heat shock in home-made competentcells. In the following, target cells will be individuallytransfected with two kinds of constructs expressing BMP۲ promoter-targeted saRNAs with the backbone construct servingas negative control. Using qRT-PCR, the relative expression ofBMP۲ and other marker genes in osteogenesis are measured atthe mRNA level in both treated and control cells.Results: Using target design tools we chose “ GAATATATTTATAGAAATATA”and “ CTGCATTTGTCCTGGATTTCG”sequences as the potent saRNAs to activate BMP۲ gene expression.The sequences were successfully cloned. Following targetcell transfection, The result would show whether our designedosteogenic dsRNAs could affect osteogenic pathway throughtargeting BMP۲ promoter. Based on literature survey and saRNAtarget design tools, We believe our designed saRNAs holda high potential to induce osteogenesis. Such a finding mayhave a great impact on gene therapy of bone associated disease,which would obviate the need for cloning of the large BMPgene by using a short RNA sequence instead.Conclusion: Our finding will provide a novel approach toup-regulate the desired genes in different cells . However, thecell-type dependency of RNAa makes it tough to make a commonalgorithm for designing saRNAs. In addition, promotersconsisting of certain elements such as the TATA box and CGIs(CpG islands) appeared to be more potent to be affected bydsRNAs.
نویسندگان
Z Hojaei Jeshvaghani
Department of Biotechnology, College of Science, University of Tehran, Tehran, Iran
M Kabiri Renani
Department of Biotechnology, College of Science, University of Tehran, Tehran, Iran
M Soleimani
Department of Hematology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran