Investigating the Coxiella burnetii Presence in Healthy Placenta of Goats with Full-Term Delivery
سال انتشار: 1402
نوع سند: مقاله کنفرانسی
زبان: انگلیسی
مشاهده: 241
نسخه کامل این مقاله ارائه نشده است و در دسترس نمی باشد
- صدور گواهی نمایه سازی
- من نویسنده این مقاله هستم
استخراج به نرم افزارهای پژوهشی:
شناسه ملی سند علمی:
MEDISM24_158
تاریخ نمایه سازی: 6 اسفند 1402
چکیده مقاله:
BACKGROUND AND ABJECTIVEIn Iran, goat farming is still a common custom. These animals are kept to production and consume raw materials like milk, meat and wool. A producer's economic situation and a concern for health and food safety are both affected by abortions. The goat industry suffers significant financial losses as a result of abortion. One of the infectious agents with the highest potential for abortion is Coxiella burnetii, witch a significant zoonotic agent that is widely prevalent worldwide. Birth products, vaginal secretions, milk, and the feces of infected domestic ruminants are the main sources of C. burnetii. This obligate intracellular pathogen is highly tenacious and resistant to numerous disinfectants, heat, UV light, and desiccation. The effects of C. burnetii on goat health include weak kids, stillbirth, and high rates of abortion in goats. The current study concentrated on the C. burnetii presence in full-term placenta from healthy goats.MATERIALS AND METHODSIn present study, forty-three pregnant Saanen goats who delivered at full term were examined. These animals didn't exhibit any clinical signs of C. burnetii infection, nor did their placentas or labor secretions seem to be having any issues. There was no history of abortion among the chosen animals. As soon as the placenta was discharged, a sample was taken. In the shortest amount of time possible, the samples were delivered to the laboratory. In samples, C. burnetii DNA was detected using PCR. DNA was extracted from the vaginal samples using DNA extraction kit (CinnaGen- Iran) according to the manufacturer’s instructions. Forward and reverse primers were used to amplify a fragment of the C. burnetii IS۱۱۱۱ gene that was ۶۸۷-bp, including TATGTATCCACCGTAGCCAGTC and CCCAACAACACCTCCTTATTC were used respectively.RESULTS AND DISCUSSIONC. burnetii DNA was found in the placenta of forty goats, according to PCR results. And after full-term delivery, these goats shed coxella. This is entirely consistent with the field observations that showed a goat's placenta can contain C. burnetii when it gives birth normally. In ۲۰۱۲, Rosette et al. inoculated pregnant goats with C. burnetii via the intranasal route. observed that newborn kids from infected goats had high amounts of C. burnetii that were ۱۸۴excreted with the placenta. Importantly, since infected goats gave birth to both live and dead kids, C. burnetii infection does not always result in abortion. According to studies, healthy excreting goats are most likely to be responsible for the long-term spread of C. burnetii in a herd. This assertion is supported by the findings of the current study. placental isolates of C. burnetii have also been shown to be more virulent than other isolates. the majority of studies carried out in Iran concentrated on the bacterium that sheds through milk and its risk factors for humans. in such a way that other methods of shedding, like placental route, were disregarded. The current study demonstrated that placenta is a significant contributor to environmental contamination and bacterial shedding. It is suggested that research could be done on the fate of infants born to healthy goats who shed C. burnetii.CONCLUSIONThe positive PCR results probably indicates the occurrence of a latent infection that may have remained in the localized to the placenta. In this situation, at the time of delivery and peri-partum, there is likely bacterial excretion in the amniotic fluid and vaginal mucus, which contaminate the environment. Studies also point out that during abortion and delivery, infected pregnant goats primarily excrete C. burnetii. Environmental contamination from such excretions raises the possibility of infection to other vulnerable goats in the herd because these bacteria can survive for extended periods of time. Accordingly, when Q fever appears in a goat herd, the controlling procedures should be maintained for a long periods of time. This pathogen's Excretion should be regarded as a major zoonotic risk to humans. The present results support the need to continue the Q fever public information, particularly among those who are occupationally exposed, and highlight the significance of this disease in monitoring and preventing programs for public and livestock health. According to the current findings and other studies of a similar nature, special attention to asymptomatically infected goats and vaccination, which has been proven to be one of the most effective methods for lowering bacterium shedding and the incidence of abortion, are important strategies.
کلیدواژه ها:
نویسندگان
Hossein Esmaeili
Associate Professor, Department of Microbiology and Immunology, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran
Seyed Mehdi Joghataei
PhD student, Department of Microbiology and Immunology, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran
Elahe Naini
Veterinary Medicine student, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran