In silico Design of shRNAs against Crimean-Congohemorrhagic fever virus RdRPs gene

سال انتشار: 1401
نوع سند: مقاله کنفرانسی
زبان: انگلیسی
مشاهده: 168

نسخه کامل این مقاله ارائه نشده است و در دسترس نمی باشد

استخراج به نرم افزارهای پژوهشی:

لینک ثابت به این مقاله:

شناسه ملی سند علمی:

MEDISM23_499

تاریخ نمایه سازی: 16 مهر 1401

چکیده مقاله:

Background and Aim : troduction: Crimean-Congo haemorrhagic fever (CCHF) is a widespreaddisease caused by a tickborne virus (Nairovirus) of the Bunyaviridae family. The CCHF viruscauses severe viral haemorrhagic fever outbreaks, with a case fatality rate of ۱۰–۴۰%. Scince theRdRPs protein has a key role in the viral reolication, we selected it as a target of RNAi.Methods : Material and Methods: ShRNA sequences were designed against RdRps gene ofCCHFV using the www.invivogen.com/sirna-wizard website and the most effective moleculeswere selected using background information. For this purpose, standard search method selectedand siRNA motifs with the desired size and thermodynamic properties were designed. Then, inorder to design hairpin, the proposed vector and loop sequences (TCAAGAG) submitted, so themost effective shRNAs with desired restriction enzyme sites were designed.Results : Results: Three potentially effective shRNA molecules were designed. Their sequencesand start target positions included CCHFVshRNA۱:GAAGCAAGGTCGTTTATGAGATCAAGAGTCTCATAAACGACCTTGCTTC ,CCHFV shRNA۲:GATGGTAAAGCTAGTAGGTGATCAAGAGTCACCTACTAGCTTTACCAC and CCHFVshRNA۳:GAGACAGGCATGGCAATACTACATCAAGAGTGTAGTATTGCCATGCCTGTCTC withrespectively start positions of ۶۰ and ۱۸۵ of CCHFV RdRPs gene gene.Conclusion : Conclusion: The results showed that there are potentially effective shRNA moleculesagainst CCHFV RdRPs gene that can suppress its translation and can be considered as an antiviralapproach based on RNAi.

کلیدواژه ها: