Prediction of a G-Quadruplex Aptamer structure by mFold servers for identification histidine sequence-containing proteins

DNA has been extensively used for target recognition in biosensors because of its stability, cost effectiveness, and easy modification. Aside from complementary nucleic acids, DNA can also recognize other types of target molecules by using DNAzymes , and aptamers of DNA structure formed on non-canonical Hoogsteen-type base pairing . G-quadruplex (G۴) structures are DNA tetraplexes that Four guanine bases associate with each other through Hoogsteen hydrogen bonds to form a guanine tetrad plane (G-quartet), and then two or more G-quartet planes stack on top of each other to form a G۴ structure . Hemin/G-Quadruplex DNAzyme can quickly detect molecular goals by the naked eyes which does not require complex instruments.In this study with the aim of designing an aptosensor to detect proteins containing histidine tag, the aptamer sequences were taken from Shijia Wu et al (TTTTTTTGGCAAGAGGGTGTGCTTAAGGTGGACACGGTGGCTTAG) and G-quadruplex from Chenchen Ge et al (GTGGG TAGGG CGGGT TGGG). To check whether these two sequences interfere with each other in the structure, Mfold servers were used. (CAGTAG) linker was chosen because when the aptamer and G-quadruplex are placed next to each other, the lowest possible delta G is formed for this structure without changing the spatial structure of the aptamer and G-quadruplex from the perspective of predicting the two dimensional structure of DNA.

کلیدواژه ها:

G-quadruplex ، Aptamer ، mFold server