Design of shRNAs against Yaba monkey tumor virus byinsulin metalloprotease-like protein gene

  • سال انتشار: 1401
  • محل انتشار: بیست و سومین کنگره بین المللی میکروب شناسی ایران
  • کد COI اختصاصی: MEDISM23_555
  • زبان مقاله: انگلیسی
  • تعداد مشاهده: 270
دانلود فایل این مقاله

نویسندگان

Soren Nooraei

D.V.M Student, Department of Pathobiology , Faculty of Veterinary Medicine, Shahrekord University , Sharekord , Iran

Azam Mokhtari

Associate Professor, Department of Pathobiology , Faculty of Veterinary Medicine, Shahrekord University , Sharekord , Iran

چکیده

Background and Aim : Yaba monkey tumor virus (YMTV) is a member of the Yata pox virusfamily. This virus is one of the few smallpox viruses that cause tumors during infection. The virusgets its name from the suburb of Yaba, Lagos because the first case of the virus was obtained fromthere. In YMTV-infected rhesus monkeys, tumors are thought to derive from histiocytes that havemigrated to the site of infection. When the histiocytes are infected, they start multiplying rapidlyand become multinucleated and eventually form a polyclonal tumor. Although, the host reservoirof YMTV has not been precisely defined, All pox virus infections have a zoonotic potential. it isassumed that the virus can at least partially cope the mammalian/human immune system byexpressing immunomodulatory proteins.Methods : ShRNA sequences were designed against insulin metalloprotease-like protein gene ofYaba monkey tumor virus using the www.invivogen.com/sirna-wizard website and the mosteffective molecules were selected using background information. For this purpose, standard searchmethod selected and siRNA motifs with the desired size and thermodynamic properties weredesigned. Then, in order to design hairpin, the proposed vector and loop sequences (TCAAGAG)submitted, so the most effective shRNAs with desired restriction enzyme sites were designedResults : One potentially effective shRNA molecule was designed. Its sequence and start targetposition included YabaV shRNA۱: CTCATATAACTTCTAGCCGTTGATTCAAGAGATCAACGGCTAGAAGTTATATGAG with start position of ۱۸ of Yaba monkeytumor virus insulin metalloprotease-like protein gene gene.Conclusion : The results showed that there are potentially effective shRNA molecules againstYaba monkey tumor virus insulin metalloprotease-like protein gene that can suppress itstranslation and can be considered as an antiviral approach based on RNA۱

کلیدواژه ها

shRNA, Yaba monkey tumor virus, insulin metalloprotease-like protein, genetherapy.

مقالات مرتبط جدید

اطلاعات بیشتر در مورد COI

COI مخفف عبارت CIVILICA Object Identifier به معنی شناسه سیویلیکا برای اسناد است. COI کدی است که مطابق محل انتشار، به مقالات کنفرانسها و ژورنالهای داخل کشور به هنگام نمایه سازی بر روی پایگاه استنادی سیویلیکا اختصاص می یابد.

کد COI به مفهوم کد ملی اسناد نمایه شده در سیویلیکا است و کدی یکتا و ثابت است و به همین دلیل همواره قابلیت استناد و پیگیری دارد.