In silico Design of shRNAs against Crimean-Congohemorrhagic fever virus RdRPs gene

  • سال انتشار: 1401
  • محل انتشار: بیست و سومین کنگره بین المللی میکروب شناسی ایران
  • کد COI اختصاصی: MEDISM23_499
  • زبان مقاله: انگلیسی
  • تعداد مشاهده: 233
دانلود فایل این مقاله

نویسندگان

Shekofe Rezaei

azam mokhtari

azam mokhtari

چکیده

Background and Aim : troduction: Crimean-Congo haemorrhagic fever (CCHF) is a widespreaddisease caused by a tickborne virus (Nairovirus) of the Bunyaviridae family. The CCHF viruscauses severe viral haemorrhagic fever outbreaks, with a case fatality rate of ۱۰–۴۰%. Scince theRdRPs protein has a key role in the viral reolication, we selected it as a target of RNAi.Methods : Material and Methods: ShRNA sequences were designed against RdRps gene ofCCHFV using the www.invivogen.com/sirna-wizard website and the most effective moleculeswere selected using background information. For this purpose, standard search method selectedand siRNA motifs with the desired size and thermodynamic properties were designed. Then, inorder to design hairpin, the proposed vector and loop sequences (TCAAGAG) submitted, so themost effective shRNAs with desired restriction enzyme sites were designed.Results : Results: Three potentially effective shRNA molecules were designed. Their sequencesand start target positions included CCHFVshRNA۱:GAAGCAAGGTCGTTTATGAGATCAAGAGTCTCATAAACGACCTTGCTTC ,CCHFV shRNA۲:GATGGTAAAGCTAGTAGGTGATCAAGAGTCACCTACTAGCTTTACCAC and CCHFVshRNA۳:GAGACAGGCATGGCAATACTACATCAAGAGTGTAGTATTGCCATGCCTGTCTC withrespectively start positions of ۶۰ and ۱۸۵ of CCHFV RdRPs gene gene.Conclusion : Conclusion: The results showed that there are potentially effective shRNA moleculesagainst CCHFV RdRPs gene that can suppress its translation and can be considered as an antiviralapproach based on RNAi.

کلیدواژه ها

shRNA, CCHFV, RdRPs, gene therapy

مقالات مرتبط جدید

اطلاعات بیشتر در مورد COI

COI مخفف عبارت CIVILICA Object Identifier به معنی شناسه سیویلیکا برای اسناد است. COI کدی است که مطابق محل انتشار، به مقالات کنفرانسها و ژورنالهای داخل کشور به هنگام نمایه سازی بر روی پایگاه استنادی سیویلیکا اختصاص می یابد.

کد COI به مفهوم کد ملی اسناد نمایه شده در سیویلیکا است و کدی یکتا و ثابت است و به همین دلیل همواره قابلیت استناد و پیگیری دارد.