Designing shRNA Targeting West Nile virus NS۳ Gene as aPotential Gene Therapy Tool Using Computational Pattern

Background and Aim : Introduction: West Nile virus (WNV) infection is a mosquito-bornezoonosis. The disease affects countries in southern, eastern and western Europe. The virus istransmitted among birds via the bite of infected mosquitoes and incidentally humans and othermammals may become infected. About ۸۰% of WNV infections in humans are asymptomatic.West Nile fever (WNF) is the most common clinical presentation. The elderly andimmunocompromised persons are at higher risk of developing West Nile neuroinvasive disease(WNND). No specific prophylaxis or treatment exists against the disease in humans. The NS۳protein has vital roles in the cleavage of polyprotein and viral pathogenesis.Methods : Material and Methods: ShRNA sequences were designed against NS۳ gene of WNusing the www.invivogen.com/sirna-wizard website and the most effective molecules wereselected using background information. For this purpose, standard search method selected andsiRNA motifs with the desired size and thermodynamic properties were designed. Then, in orderto design hairpin, the proposed vector and loop sequences (TCAAGAG) submitted, so the mosteffective shRNAs with desired restriction enzyme sites were designed.Results : Results: Two potentially effective shRNA molecules were designed. Their sequencesand start target positions included WNVshRNA۱:GAAATGAGATCGTTGATGTCATCAAGAGTGACATCAACGATCTCATTTC andWNV shRNA۲:GCAGCCAGAGGATACATAGCATCAAGAGTGCTATGTATCCTCTGGCTGC withrespectively start positions of ۶۰ and ۱۸۵ of WNV NS۳ gene.Conclusion : Conclusion: The results showed that there are potentially effective shRNA moleculesagainst WNV NS۳ gene that can suppress its translation and can be considered as approach againstthe disease in humans and animals.

کلیدواژه ها:

shRNA ، WN ، NS۳ ، gene therapy.